1QWB
NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
Changes made to a PDB entry after its initial release are considered to be either “major” or “minor”. The latest minor version of each major version is available as a file download. More information about the PDB versioning is available.
| Version Number | Version Date | Version Type/Reason | Version Change | Revised CIF Category | |
|---|---|---|---|---|---|
| 1.0 | 2003-11-25 | Initial release | |||
| 1.1 | 2008-04-29 | Version format compliance | |||
| 1.2 | 2011-07-13 | Version format compliance | |||
| 1.3 | 2020-09-09 | Data collection, Derived calculations, Structure summary | ndb_struct_conf_na, ndb_struct_na_base_pair, ndb_struct_na_base_pair_step, pdbx_nmr_software, pdbx_struct_assembly, pdbx_struct_oper_list, struct, struct_conn | ||
| 1.4 | 2024-05-01 | Data collection, Database references | chem_comp_atom, chem_comp_bond, database_2 | Download |
