1QWB

NMR structure of 5\'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3\' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

Explore Sequence Annotations in 3D

RCSB PDB Core Operations are funded by the U.S. National Science Foundation (DBI-2321666), the US Department of Energy (DE-SC0019749), and the National Cancer Institute, National Institute of Allergy and Infectious Diseases, and National Institute of General Medical Sciences of the National Institutes of Health under grant R01GM133198.