1QWB

NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

SOLUTION NMR

NMR Experiment
Experiment	Type	Sample Contents	Solvent	Ionic Strength	pH	Pressure	Temperature (K)	Spectrometer
1	2D NOESY	1-1.5mM sNRE26 NA, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3, 95% H2O, 5% D2O	95% H2O/5% D2O	100mM KCl	7	ambient	278
2	2D NOESY	1-1.5mM sNRE26 NA, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3	99.999% D2O	100mM KCl	7	ambient	298
3	2D TOCSY	1-1.5mM sNRE26 NA, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3	99.999% D2O	100mM KCl	7	ambient	298
4	DQF-COSY	1-1.5mM sNRE26 NA, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3	99.999% D2O	100mM KCl	7	ambient	298
5	1H-13C HSQC or HMQC	1mM sNRE26 U 15N/13C, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3	99.999% D2O	100mM KCl	7	ambient	298
6	1H-15N HMQC	1mM sNRE26 U 15N/13C, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3, 95% H2O, 5% D2O	95% H2O/5% D2O	100mM KCl	7	ambient	278

NMR Spectrometer Information
Spectrometer	Manufacturer	Model	Field Strength
1	Bruker	DMX	500
2	Bruker	DMX	600

NMR Refinement
Method	Details	Software
simulated annealing		XwinNMR

NMR Ensemble Information
Conformer Selection Criteria	all calculated structures submitted,structures with acceptable covalent geometry,structures with favorable non-bond energy,structures with the least restraint violations,structures with the lowest energy
Conformers Calculated Total Number	17
Conformers Submitted Total Number	17
Representative Model	1 (lowest energy)

Additional NMR Experimental Information
Details	Assignment methodology for this molecule is described in J. Biomol. NMR 9, 259-272 (1997) and Prog. in Nuc. Magn. Resonan. Spec. 32, 287-387 (1998).

Computation: NMR Software
#	Classification	Version	Software Name	Author
1	collection	XwinNMR	2.6	Bruker
2	data analysis	AURELIA	3.108	Bruker
3	structure solution	X-PLOR	NIH	Brunger
4	refinement	X-PLOR	NIH	Brunger

RCSB PDB Core Operations are funded by the U.S. National Science Foundation (DBI-2321666), the US Department of Energy (DE-SC0019749), and the National Cancer Institute, National Institute of Allergy and Infectious Diseases, and National Institute of General Medical Sciences of the National Institutes of Health under grant R01GM133198.