Download MendeleyProtein structure
Elkayam, E., Joshua-Tor, L.To be published.
5T7B
Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrTTR guide RNA complex
- PDB DOI: https://doi.org/10.2210/pdb5T7B/pdb
- NAKB: 5T7B
- Classification: HYDROLASE/RNA
- Organism(s): Mus musculus, Homo sapiens
- Expression System: Spodoptera frugiperda
- Mutation(s): Yes
- Deposited: 2016-09-02 Released: 2016-12-14
- Funding Organization(s): Howard Hughes Medical Institute (HHMI)
Experimental Data Snapshot
- Method: X-RAY DIFFRACTION
- Resolution: 2.53 Å
- R-Value Free: 0.238
- R-Value Work: 0.194
- R-Value Observed: 0.196
wwPDB Validation 3D Report Full Report
This is version 1.2 of the entry. See complete history.
Literature
Macromolecules
Find similar proteins by:
(by identity cutoff) | 3D Structure
Entity ID: 2 | |||||
|---|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Details | Image |
| Protein argonaute-2 | B [auth A] | 861 | Homo sapiens | Mutation(s): 2 Gene Names: AGO2, EIF2C2 EC: 3.1.26 |  |
UniProt & NIH Common Fund Data Resources | |||||
Find proteins for Q9UKV8 (Homo sapiens) Explore Q9UKV8 Go to UniProtKB: Q9UKV8 | |||||
PHAROS: Q9UKV8 GTEx: ENSG00000123908 | |||||
Entity Groups | |||||
| Sequence Clusters | 30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity | ||||
| UniProt Group | Q9UKV8 | ||||
Sequence AnnotationsExpand | |||||
| |||||
Find similar nucleic acids by: Sequence | 3D Structure
Entity ID: 1 | |||||
|---|---|---|---|---|---|
| Molecule | Chains | Length | Organism | Image | |
| RNA (UVP)UAUAGAGCAAGAACACUGUU | A [auth R] | 21 | Mus musculus |  | |
Sequence AnnotationsExpand | |||||
| |||||
Small Molecules
| Ligands 1 Unique | |||||
|---|---|---|---|---|---|
| ID | Chains | Name / Formula / InChI Key | 2D Diagram | 3D Interactions | |
| IPH Query on IPH | C [auth A], D [auth A] | PHENOL C6 H6 O ISWSIDIOOBJBQZ-UHFFFAOYSA-N |  | ||
Experimental Data & Validation
Experimental Data
- Method: X-RAY DIFFRACTION
- Resolution: 2.53 Å
- R-Value Free: 0.238
- R-Value Work: 0.194
- R-Value Observed: 0.196
- Space Group: P 1 21 1
Unit Cell:
| Length ( Å ) | Angle ( ˚ ) |
|---|---|
| a = 63.207 | α = 90 |
| b = 108.306 | β = 106.62 |
| c = 68.821 | γ = 90 |
| Software Name | Purpose |
|---|---|
| PHENIX | refinement |
| XDS | data reduction |
| SCALA | data scaling |
| PHASER | phasing |
Entry History & Funding Information
Deposition Data
- Released Date: 2016-12-14 Deposition Author(s): Elkayam, E., Joshua-Tor, L.
| Funding Organization | Location | Grant Number |
|---|---|---|
| Howard Hughes Medical Institute (HHMI) | United States | -- |
Revision History (Full details and data files)
- Version 1.0: 2016-12-14
Type: Initial release - Version 1.1: 2019-11-20
Changes: Author supporting evidence - Version 1.2: 2023-10-04
Changes: Data collection, Database references, Refinement description
